Marissa has twice as much money as Frank. Christina has $20 more than Marissa. If Christina has $100, how much money does Frank have?

Answers

Answer 1

Answer:

He has 40$

Step-by-step explanation:

Cuz 100-20=80 then if she has twice as more as him then you divide 80 by 2 then get 40


Related Questions

Let X be a topological space and A ⊂ X. The closure of A, denoted
A¯, is the intersection of all closed sets containing A.
(a) Show that A¯ is the smallest closed subset of X containing A, in
the following sense: if A ⊂ F ⊂ X and F is closed, then A¯ ⊂ F.

Answers

The "closure(A⁻)" of "subset-A" in a topological-space X is the intersection of all "closed-sets" containing A. It is smallest closed subset of X that contains A, means that if A⊂F⊂X and F is closed, then A⁻ is a subset of F.

In order to show that the closure(A⁻) is the smallest closed subset of X  which contains "A", we need to prove that if A ⊂ F ⊂ X and F is closed, then A⁻ ⊂ F,

We know that, A⁻ is intersection of all "closed-sets" containing A. Since F is "closed-set" which contains "A", it is one of the sets in the intersection defining A⁻. So, A⁻ is contained in F.

To show that A⁻ ⊂ F, we consider an arbitrary point x ∈ A⁻, which means that x is in the intersection of all closed sets containing A. Since, F is one such "closed-set" containing A, x must be in F as well.

Since x was an "arbitrary-point" in A⁻, we have shown that every point in A⁻ is also in F, So, A⁻ ⊂ F.

Therefore, we have proved that if A ⊂ F ⊂ X and F is closed, then A¯ ⊂ F.

Learn more about Topological Space here

https://brainly.com/question/31392876

#SPJ4

Jennifer painted a tabletop that is shaped like a circle. the circumference of the tabletop is 6π. Which measurement is closest to the area of the tabletop in square feet?

Answers

28.26 sq. Ft is the area of the table top

28.26 sq. Ft is the area of the table top

You must exert a force of 4.5 N on a book to slide it across a table. If you moved it 5 meters. How much work was done on the book?

Answers

Answer:

22.5 J

Step-by-step explanation:

The work done by an object can be found by using the formula

workdone = force × distance

From the question we have

workdone = 4.5 × 5

We have the final answer as

22.5 J

Hope this helps you

A swimmer swims 2 kilometers every 15 minutes. If he comes to swim at the same rate which graph best represents his swimming speed in kilometers per minute

Answers

Answer:

62

Step-by-step explanation:

divide lang yan.piste kasi bat kailangan 20 letters

Answer:

la respuesta es la D

Step-by-step explanation:

la velocidad es constante

Use the given conditions to write an equation for the line. Passing through (-8,6) and parallel to the line whose equation is 8x - 3y -4 = 0 The equation of the line is (Simplify your answer. Type an equation using X and y as the variables.

Answers

The equation of the line that passes through (-8, 6) and parallel to the line whose equation is 8x - 3y -4 = 0, is 3y - 8x + 46 = 0

How do i determine the equation of the line?

First, we shall obtain the slope of the line. Details below:

8x - 3y -4 = 0

Rearrange the equation with y as the subject, we have

8x - 4 = 3y

y = 8x/3 - 4/3

Thus,

Slope (m₁) = 8/3

Recall,

Slope of parallel lines are equal.

Thus,

The slope of line, is given as:

m₂ = m₁ = 8/3

Now, we shall obtain the equation of line. Details below

Coordinate = (-8, 6) x coordinate 1 (x₁) = -8y coordinate 1 (y₁) = 6Slope of line (m₂) = 8/3Equation of line =?

y - y₁ = m₂(x - x₁)

y - 6 = 8/3(x - (-8))

y - 6 = 8/3(x + 8)

Multiply through by 3

3(y - 6) = 8(x + 8)

Clear bracket

3y - 18 = 8x - 64

Rearrange

3y - 8x - 18 + 64 = 0

3y - 8x + 46 = 0

Thus, the equation of line is 3y - 8x + 46 = 0

Learn more about coordinate geometry:

https://brainly.com/question/20712656

#SPJ4

asfjpasjfaafdad adsafdshfd

Answers

4020

you're supposed to multiply the length value by 1760

:P

A company needs to determine the optimum power and time settings for their new licorice-flavored microwaveable popcorn. They want to find a combination of power and time that delivers high-quality popcorn with less than 11% of the kernels left unpopped, on average-a value that their market research says is demanded by their customers. Their research department experiments with several settings and determines that power 9 at 4 minutes is optimum. Their tests confirm that this setting meets the less than 11% requirement. They change the instructions on the box and promote a new money back guarantee of less than 11% unpopped kernels. Complete parts a) and b) below.
a) If, in fact, the setting results in more than 11% kernels unpopped, what kind of error have they made? What will the consequence be for the company? What are the null and alternative hypotheses in this case?
A. H_o: μ< 11 vs. H_A: μ = 11
B. H_o: μ= 11 vs. H_A: μ> 11
C. H_o: μ= 11 vs. H_A: μ< 11
D. H_o: μ> 11 vs. H_A: μ = 11
b) To be sure that the method was successful, the research department popped 8 more bags of popcorn (selected at random) at this setting. All were of high quality, with the percentages of unpopped kernels being 6.7,12.9, 10.6, 7, 7.1, 3.1, 2.0, and 4.8. Does this provide evidence that they met their goal of an average of fewer than 11% unpopped kernels? Assume α=0.05.
c) Find T
d) Find P

Answers

A The null and alternative hypotheses in this case are:

Null hypothesis: H_o: μ ≥ 11

Alternative hypothesis: H_A: μ < 11

B We have statistically significant evidence to conclude that the setting results in less than 11% kernels unpopped.

C The t-statistic is -2.94.

d) The p-value is 0.004.

How to explain the information

a) In this case, the company has made a Type I error. This is when the null hypothesis is rejected, even though it is true. In this case, the company would be rejecting the hypothesis that the setting results in less than 11% kernels unpopped, even though it is actually true. The consequence of this would be that the company would be losing money on refunds for popcorn that is not actually defective.

b) In order to answer this question, we need to calculate the t-statistic and the p-value.

The t-statistic is calculated as follows:

t = (x - μ) / (s / √n)

Substituting these values into the formula for the t-statistic, we get:

t = (6.7 - 11) / (3.5 / √8)

= -2.94

The p-value is the probability of obtaining a t-statistic that is at least as extreme as the one we observed, assuming that the null hypothesis is true. In this case, the p-value is 0.004.

c) The t-statistic is -2.94.

d) The p-value is the probability of obtaining a t-statistic that is at least as extreme as the one we observed, assuming that the null hypothesis is true. In this case, the p-value is 0.004.The p-value is 0.004.

Learn more about hypothesis on

https://brainly.com/question/606806

#SPJ4

A Gallup poll conducted in November 2010 found that 493 of 1050 adult Americans believe it is the responsibility of the federal government to make sure all Americans have healthcare coverage.
Use Minitab Express to construct the following confidence intervals. Report your answers as decimals (not percents) rounded to three decimal places, where applicable.
a) We are 95% confident that the proportion of all adult Americans who believe it is the responsibility of the federal government to make sure all Americans have healthcare coverage is between ____ and ____
b) We are 99% confident that the proportion of all adult Americans who believe it is the responsibility of the federal government to make sure all Americans have healthcare coverage is between _____ and ____

Answers

The sample proportion is calculated by dividing the number of individuals who believe it is the responsibility of the federal government (493) by the total number of adult Americans surveyed (1050).

a) For the 95% confidence interval, we use the formula: Sample proportion ± Z * (Standard error). The value of Z is determined by the desired confidence level. In this case, for a 95% confidence level, Z is the critical value corresponding to a two-tailed test. By plugging in the values, we can calculate the lower and upper limits of the interval.

b) Similarly, for the 99% confidence interval, we use the same formula but with the appropriate critical value for a 99% confidence level.

Using Minitab Express or statistical tables, we can find the critical values and compute the confidence intervals.

Hence, the 95% confidence interval represents our level of confidence that the true proportion of adult Americans who believe it is the responsibility of the federal government to provide healthcare coverage lies within the reported interval. Similarly, the 99% confidence interval provides a higher level of confidence in capturing the true proportion.

Learn more about critical value here:

https://brainly.com/question/32389590

#SPJ11

Rosalind Franklin played an important role in the discovery of DNA's structure. Her data was used to support Watson's and Crick's hypothesis that DNA had the structure of a double helix. Even with this data and support from other scientists, the structure of DNA was not a widely accepted theory. Select all of the reasons why was their discovery was not considered a theory at the time of the paper's publication? 1. A newly released hypothesis must wait a least a year before the scientific community can vote for it to become a theory. 2. Theories are never developed by three people. 3. Theories need to undergo peer-review. 4.The hypothesis wasn't supported by their own data.

Answers

Answer:

The correct option is;

3. Theories need to undergo peer-review

Step-by-step explanation:

Within the scientific community, a theory has to be peer-reviewed by subject matter experts before it can be normally considered a valid theory. The peer-review process is one in which another scientific expert on the subject analyze, study, and repeat the experiments in the same conditions as stated in a publication submitted to a journal as a theory. The peer-review process aims to confirm the theory. A discovery which survives the peer review process will be considered a scientific theory and can then be expanded upon.

Which value below represents the solution to 64 = 4u

Answers

Answer:

You didnt write the options

Answer:

u=16

Step-by-step explanation:

64=4u

divide both sides by 4

16=u

as of today, the team has played seven games, and _____________ has won them all.

Answers

As of today, the team has played seven games, and "the team" has won them all.

This statement indicates that the team, whose specific name or identity is not provided, has achieved a perfect winning record by emerging victorious in all seven games they have participated in. The emphasis is on the collective success of the team rather than attributing the wins to any particular individual or naming the team itself. The phrase "has won them all" highlights the team's unbeaten streak and implies their dominance in the competition.

To know more about  probability click here: brainly.com/question/31828911 #SPJ11

Help me please thanks

Answers

Answer:

64 square cm

Step-by-step explanation:

(I pulled this out of the comments in case someone else needs this answer. Easier to see as an answer than as comments in the app)

Area 2 is easier, so we’ll start with that one. Area of a rectangle is length x width.

8 x 6 = 48 square cm

Area 1 is a triangle, so the formula is 1/2(base)(height). The height of the triangle is 8, because it’s the same as the base of the rectangle. The base of the triangle is 4, because we can subtract the 6 from the rectangle from the total side length of 10. Does that make sense?

So 1/2 (4)(8)= 1/2(32) = 16 square cm

Then we add 16 + 48 = 64 square cm

I need to know how much metal is needed to make the can

Answers

Answer:

we don't have any wasted metal and everything goes perfectly. In the real world, waste is inevitable.

The height of a cylindrical vase is 11 inches as shown below. The base of the cylinder has a diameter of 4½ inches. Which measurement is closest to the volume of the cylinder in cubic inches? * 34 points 1,710.6 cubic inches 155.51 cubic inches 699.79 cubic inches 174.95 cubic inches

Answers

Answer:

174.95

Step-by-step explanation:

Volume=πr^2h

3.142 * (4.5÷2)^2 *11

=174.95

p is a plane in r3. its equation is: x 4y − 3z = 0. this plane is the nullspace of what matrix a ? find the basis for the nullspace of a. find the basis for the line p⊥ that is perpendicular to p.

Answers

The vector [1, 1, 1]ᵀ as it is symmetrical to the ordinary vector. Thus, "[1, 1, 1]T" serves as the foundation for the line p.

We can rewrite the plane's equation as a matrix equation to find the matrix A whose nullspace matches the given plane. The plane's equation is as follows:

x - 4y + 3z = 0

We can revise it in lattice structure as:

Where [A] is a 1x3 matrix and [x, y, z]T is a column vector, [A] = [0]. The rows of the matrix [A] will serve as the equation's coefficients for x, y, and z due to the equation's homogeneity and linearity.

As a result, matrix A is:

[A] = [1, -4, 3] We must solve the equation A * x = 0, where x is a column vector, in order to determine the nullspace's basis. For this situation, we really want to address:

We can represent it as a system of equations: [1, -4, 3,] [x, y, z]T = [0].

x - 4y + 3z = 0

To track down the reason for the nullspace, we settle the arrangement of conditions and express the arrangement concerning boundaries. Let's figure out the system:

x = 4y - 3z

Picking y = t (a boundary), we can revamp the arrangement as:

The nullspace of matrix A is spanned by the vector [4, 1, 1]T, so "[4, 1, 1]T" serves as the foundation for the nullspace of A. Since x = 4t, y = t, and z = t,

Presently, to find the reason for the line p⊥ that is opposite to p, we know that any vector in p⊥ is symmetrical to any vector in p. Hence, the reason for p⊥ can be found by finding a vector that is symmetrical to the ordinary vector of p (which is [1, - 4, 3]ᵀ).

We can pick the vector [1, 1, 1]ᵀ as it is symmetrical to the ordinary vector. Thus, "[1, 1, 1]T" serves as the foundation for the line p.

To know more about matrix equation refer to

https://brainly.com/question/27572352

#SPJ11

A one-sided significance test gives a P-value of .02. From this we can a) Reject the null hypothesis with 97% confidence. b) Reject the null hypothesis with 98% confidence. c) O Say that the probability that the null hypothesis is false is .02. d) Say that the probability that the null hypothesis is true is .02.

Answers

A one-sided significance test gives a P-value of .02. From this we can conclude that we can reject the null hypothesis with 98% confidence.

Here’s why: In statistical hypothesis testing, the p-value is the probability of obtaining a test statistic at least as extreme as the observed value, assuming that the null hypothesis is true. If the p-value is less than or equal to the significance level (α), the null hypothesis can be rejected. Conversely, if the p-value is greater than the significance level, there is insufficient evidence to reject the null hypothesis. Since a one-sided significance test was performed, we are only interested in the probability that the test statistic will fall in one tail of the distribution.

Thus, the p-value is the probability of obtaining a test statistic as extreme as the observed value in one tail of the distribution. If the p-value is .02, this means that there is a 2% chance of obtaining a test statistic as extreme or more extreme than the observed value if the null hypothesis is true. Since the p-value is less than the standard significance level of .05, we can reject the null hypothesis with 98% confidence. This is because we can be 98% confident that the true population parameter falls in the alternative hypothesis range.

know more about null hypothesis

https://brainly.com/question/30821298

#SPJ11

PLEASE HELP! What is the ratio of the volumes of two spheres, if the ratio of their radii is 13: 9

Answers

Answer:

[tex] V_1 : V_2= 2197 : 729[/tex]

Step-by-step explanation:

Let the volumes of both the spheres be [tex] V_1, \:V_2[/tex] and their radii be [tex] r_1, \:r_2[/tex] respectively.

[tex] \huge r_1 : r_2= 13 : 9[/tex] (given)

[tex] \implies\huge \frac{r_1}{r_2}= \frac{13}{9}.....(1)[/tex]

[tex] \huge \frac{V_1}{V_2}=\frac{\cancel {\frac{4}{3} \pi} r_1^3}{\cancel {\frac{4}{3} \pi} r_2^3}[/tex]

[tex] \huge \frac{V_1}{V_2}=\frac{ r_1^3}{r_2^3}[/tex]

[tex]\huge \frac{V_1}{V_2}=\bigg(\frac{ r_1}{r_2}\bigg) ^3..... (2)[/tex]

From equations (1) & (2), we have:

[tex]\huge \frac{V_1}{V_2}=\bigg(\frac{13}{9}\bigg) ^3[/tex]

[tex] \huge \frac{V_1}{V_2}=\frac{2197}{729}[/tex]

[tex] \huge \therefore V_1 : V_2= 2197 : 729[/tex]

Thus, the ratio of the volumes of two spheres would be 2197 : 729.

Answer:

2197:729

hope it helps

please mark brainliest

To find the x-intercept, we let y = 0 and solve for x and to find y-intercept, we let x=0 and solve for y. Figure out the x-intercept and y-intercept in given equation of the line. 6x + 2y = 12

Answers

Answer:

        X-intercept: (2, 0)         Y-intercept: (0, 6)

Step-by-step explanation:

X-intercept means y-coordinate of 0:

6x +2×0 = 12

6x = 12

  x = 2         ← x-coordinate

Y-intercept means x-coordinate of 0:

6×0 + 2y = 12

2y = 12

  y = 6         ← y-coordinate

I have a statistic that is normally distributed with a very large sample size. I add a single subject that is way above the median to the sample. What is likely to happen?

Answers

Adding a single subject that is way above the median to a sample with a very large sample size is likely to have a minimal impact on the overall distribution and statistics of the sample.

When the sample size is very large and the distribution of the statistic is approximately normal, the Central Limit Theorem states that the distribution of the sample mean approaches a normal distribution, regardless of the underlying population distribution. This means that the sample mean is less sensitive to individual extreme values.

If a single subject is added to the sample that is way above the median, it will have a relatively small effect on the overall sample mean. This is because the impact of a single extreme value diminishes as the sample size increases.

When adding a single subject that is way above the median to a sample with a very large sample size, the effect on the overall distribution and statistics of the sample is expected to be minimal. The large sample size ensures that the sample mean remains robust and less influenced by individual extreme values. Therefore, the addition of a single subject with a very high value is unlikely to significantly alter the characteristics of the sample distribution or the calculated statistics such as the mean or standard deviation.

To know more about median , visit

https://brainly.com/question/26177250

#SPJ11

Julio recibió $640.000: gastó las ⅜ partes para pagar sus estudios y la ¼ parte para reparar el auto, ¿cuánto dinero le queda?

Answers

Answer:

Resto= $240.000

Step-by-step explanation:

Dada la siguiente información:

Cantidad total de dinero= $640.000

Costo de estudio= 3/8= 0,375

Costo de auto= 1/4= 0,25

Primero debemos calcular la cantidad total gastada, y después la diferencia:

Costo de estudio= 0,375*640.000= 240.000

Costo de auto= 0,25*640.000= 160.000

Gasto total= $400.000

Resto= 640.000 - 400.000

Resto= $240.000

Lin opened a savings account that pays 5.25% interest and deposited $5000. If she makes no deposits and no withdrawals for 3 years, how much money will be in her account?

Answers

Answer:

$5829.57

Step-by-step explanation:

Annually compounding interest formula: [tex]PV(1+i)^t[/tex]

5000(1+.0525)^3

5829.567266

which rounds to: 5829.57

Find the characteristic c using a 64-bit long real equivalent decimal number -147 with mantissa f = 0.1484375

Answers

Characteristic 'c' using a 64-bit long real equivalent decimal number -147 with mantissa 'f' = 0.1484375, the number can be expressed as -1.48 x 10^2. The characteristic 'c' is the exponent of the power of 10. Therefore, the characteristic 'c' is -2.

The scientific notation representation of a real number is given by 'm x 10^c', where 'm' is the mantissa and 'c' is the characteristic. In this case, we have a 64-bit long real equivalent decimal number -147 with mantissa 'f' = 0.1484375. The number can be written as -1.48 x 10^2.

To determine the characteristic 'c', we look at the exponent of the power of 10. In this case, the exponent is 2. However, since the number is negative, the characteristic is also negative. Therefore, the characteristic 'c' is -2.In summary, for the given number -147 with mantissa 0.1484375, the characteristic 'c' is -2.

Learn more about decimal number click here: brainly.com/question/4708407

#SPJ11

Callum is walking 270 miles to raise money for cancer research. He plans to walk 1/9 of the distance each day. After 7 days, how much farther does he have to walk to reach his goal?

Answers

270-(7/9x270)=60miles

Use the consumption function C = C₁ + bY and the income function Y=C+ S. to derive expressions for the MPC, APC, MPS. and APS. 7 marks 5. Given the consumption functions C= 50+ 0.5Y, Deduce expressions for the marginal propensity to save and the average propensity to save. Show that the MPS>APS. Confirm this statement by evaluating APS and MPS at Y = 20. 6 marks 6. Find the derivatives of the following functions. AC = + QI(Q) 3 marks Page 2 y=(√2+1)(√2-3) 3 marks 7. Determine the intervals along which each of the following curves is increasing or decreasing (consider the positive half of the plane, z>0) 5 marks (a) AC=Q²-20Q+120 (b) TR=50Q-Q²

Answers

In the given problem, we start by deriving expressions for the marginal propensity to consume (MPC), average propensity to consume (APC), marginal propensity to save (MPS), and average propensity to save (APS) using the consumption function and income function.

Deriving expressions for MPC, APC, MPS, and APS:

Using the consumption function C = C₁ + bY and the income function Y = C + S, we can derive the following expressions:

MPC (Marginal Propensity to Consume) = ΔC / ΔY

APC (Average Propensity to Consume) = C / Y

MPS (Marginal Propensity to Save) = ΔS / ΔY

APS (Average Propensity to Save) = S / Y

Deducing expressions for MPS and APS:

Given the consumption function C = 50 + 0.5Y, we can deduce the expressions for MPS and APS as follows:

MPS = ΔS / ΔY = Δ(Y - C) / ΔY = 1 - MPC

APC = C / Y = (50 + 0.5Y) / Y

APS = S / Y = (Y - C) / Y = 1 - APC

Confirming MPS > APS:

To confirm that MPS is greater than APS, we evaluate them at Y = 20:

MPS = 1 - MPC = 1 - 0.5 = 0.5

APC = C / Y = (50 + 0.5 * 20) / 20 = 52.5 / 20 = 2.625

APS = 1 - APC = 1 - 2.625 = -1.625

Since APS is negative and MPS is positive, it is evident that MPS > APS.

Derivatives of the given functions:

a) AC = Q² - 20Q + 120

The derivative of AC with respect to Q is: d(AC)/dQ = 2Q - 20

b) TR = 50Q - Q²

The derivative of TR with respect to Q is: d(TR)/dQ = 50 - 2Q

Determining intervals of increase or decrease:

a) AC = Q² - 20Q + 120

The quadratic function AC has a positive coefficient for the quadratic term (Q²), indicating a U-shaped curve. It opens upward, which means it is increasing for Q values less than the vertex of the parabola (Q = 10) and decreasing for Q values greater than the vertex.

b) TR = 50Q - Q²

The quadratic function TR has a negative coefficient for the quadratic term (Q²), indicating a downward-opening parabola. It is decreasing for all values of Q.

In summary, we derived expressions for MPC, APC, MPS, and APS using the consumption function and income function. We confirmed that MPS > APS by evaluating them at a given income level.

Learn more about quadratic function here:

https://brainly.com/question/18958913

#SPJ11

| 50 Points | Please give explanation | Reporting false answers | Giving correct brainliest

Answers

The one in the middle is right one. Because it has the same information as in the graph

Answer: answer is D

Step-by-step explanation:

because science is more important than life

2
M2|L23
Division Diver Duo
5,626 ÷ 62
How many times can 62 go into 562

Answers

The result of 5,626 divided by 62 is approximately 90 with a remainder of 48.

To calculate the division of 5,626 by 62, you can use long division. Here are the steps:

          90

   ______________

62 | 5,626

      - 4,96

        -----

          1,66

          1,55

          ----

            110

             62

            ----

             48

Therefore, the result of 5,626 divided by 62 is approximately 90 with a remainder of 48.

Learn more about division click;

https://brainly.com/question/2273245

#SPJ1

Here is my question.

Answers

Answer: True False True true

Step-by-step explanation:

Answer:

true

false

true

true

Step-by-step explanation:

The marginal PMFs for two INDEPENDENT random variables are given as follows 1/8 x = -1 Px(x) 1/2 = 0 3/8 1 = X = X = - py(y) = Py = 5/16 y=-1 9/16 y=0 1/8 = y = 1 a) Find the joint PMF for X, Y

Answers

The joint PMF for X, Y is given by the following table:

x\y 5/128   9/128   1/64   5/32   9/32   1/16   15/128   27/128   3/64

The joint probability mass function (PMF) of two discrete random variables is a function that maps each pair of outcomes of the random variables to a probability. In particular, the joint PMF gives the probability that the random variables take a certain pair of values on each trial. Therefore, we have to find the probability that the random variables X and Y take each of the six possible values.

Therefore, the joint PMF for X, Y is given as follows:

For x = -1 and y = -1,

P(X = -1, Y = -1)

= P(X = -1)P(Y = -1)

= (1/8)(5/16)

= 5/128

For x = -1 and y = 0,

P(X = -1, Y = 0) = P(X = -1)P(Y = 0)

= (1/8)(9/16)

= 9/128

For x = -1 and y = 1,

P(X = -1, Y = 1) = P(X = -1)P(Y = 1)

= (1/8)(1/8)

= 1/64

For x = 0 and y = -1,

P(X = 0, Y = -1) = P(X = 0)P(Y = -1)

= (1/2)(5/16)

= 5/32

For x = 0 and y = 0,

P(X = 0, Y = 0) = P(X = 0)P(Y = 0)

= (1/2)(9/16)

= 9/32

For x = 0 and y = 1,

P(X = 0, Y = 1) = P(X = 0)P(Y = 1)

= (1/2)(1/8)

= 1/16

For x = 1 and y = -1,

P(X = 1, Y = -1) = P(X = 1)P(Y = -1)

= (3/8)(5/16)

= 15/128

For x = 1 and y = 0, P(X = 1, Y = 0) = P(X = 1)P(Y = 0)

= (3/8)(9/16)

= 27/128

For x = 1 and y = 1,

P(X = 1, Y = 1) = P(X = 1)P(Y = 1)

= (3/8)(1/8)

= 3/64

Therefore, the joint PMF for X, Y is given by the following table:

x\y 5/128   9/128   1/64   5/32   9/32   1/16   15/128   27/128   3/64

To know more about PMF, visit the link : https://brainly.com/question/30765833

#SPJ11

on number 6 what should i color in

Answers

Answer:

For 5/11 shade in the third bubble (0.45 repeating)

A pizza cut into 8 pieces cost $10.00.
What is the cost per piece?

Answers

Answer:

$1.25

Step-by-step explanation:

10/8 =1.25

Answer:

$1.25

Step-by-step explanation:

just divided 10 with 8

Other Questions
The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan.